Synonymous Mutation Generator

Enter your input sequence below.

Usage

Example of good input: GGCCGGGAGGAGACCATCAACGGCTCC

Your input sequence should be in codon reading frame 1 and a multiple of 3.

Your input sequence should not have line breaks/spaces and should not have characters other than ACTG. It should also not contain a stop codon.

About

This tool takes a protein coding DNA sequence and generates synonymous mutations (human codon optimized) to output a synonymous DNA sequence.

This tool uses the standard codon table and does not consider the mitochondrial codon system.

If the input sequence is an RNAi target, this tool can be used to generate an RNAi-resistant sequence that preserves protein coding sequence.

Please remember that synonymous mutations are not necessarily silent. While they should not result in any changes to amino acid sequence, these mutations can have other effects!

Check out the manuscript (with lots of worked examples) at bioRxiv, and please cite if you found this useful.

Last updated: 17NOV2024 to add stripping of spaces before/after sequence